View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_33 (Length: 247)
Name: NF18503_low_33
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_33 |
 |  |
|
| [»] scaffold1949 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 37956409 - 37956345
Alignment:
| Q |
9 |
agatgaacagtataaagttaaaatataatgatggattgagatgcaaatatatggagattgagatg |
73 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37956409 |
agatgaacaatataaagttaaaatataatgatggattgagatgcaaatatatggagattgagatg |
37956345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 229
Target Start/End: Complemental strand, 37956288 - 37956190
Alignment:
| Q |
130 |
caaatttgtacaatatttgattcatgtaaatacaaatagtttttgaacttataattgagtttgaattagtgtggttttgccaacaaaattttttaggata |
229 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||| | ||| || |||| ||||| ||||| ||||||| || |||| ||||||||| |||||||||| |
|
|
| T |
37956288 |
caaatttgtacaatatttgagtcatataaacacaaacattttgtgtacttctaattaagttttaattagtttgatttt-ccaacaaaagcttttaggata |
37956190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1949 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold1949
Description:
Target: scaffold1949; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 163 - 113
Alignment:
| Q |
9 |
agatgaacagtataaagttaaaatataatgatggattgagatgcaaatata |
59 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
163 |
agatgaatagtataaagttaaaatataacaatggattgagattcaaatata |
113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University