View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_37 (Length: 236)
Name: NF18503_low_37
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 21592324 - 21592108
Alignment:
| Q |
1 |
ttagaggcacagaggttaagactgaatttgatgatgaggatgaaggcaaggtcgttcttgttgtgcatgatacaaagcctcattttcttgatggcagaat |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592324 |
ttagaggcatagaggttaagactgaatttgatgatgaggatgaaggcaaggtcgttcttgttgtgcatgatacaaagcctcattttcttgatggcagaat |
21592225 |
T |
|
| Q |
101 |
tgtttttaccaagcaggcagagccagttatgccgataaaagatccaacatctgacatggctataatttctcgcaaaggatctgcgatggtaagagaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592224 |
tgtttttaccaagcaggcagagccagttatgccgataaaagatccaacatctgacatggctataatttctcgcaaaggatctgcgatggtaagagaaatc |
21592125 |
T |
|
| Q |
201 |
catgggaagcagagttc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21592124 |
catgggaagcagagttc |
21592108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 69 - 220
Target Start/End: Original strand, 42096783 - 42096934
Alignment:
| Q |
69 |
gatacaaagcctcattttcttgatggcagaattgtttttaccaagcaggcagagccagttatgccgataaaagatccaacatctgacatggctataattt |
168 |
Q |
| |
|
||||||||||||| |||||||| |||||| |||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42096783 |
gatacaaagcctccctttcttgacggcagagttgtttataccaagcaggcagagcctattatgccaataaaagatccaacatctgacatggctttaattt |
42096882 |
T |
|
| Q |
169 |
ctcgcaaaggatctgcgatggtaagagaaatccatgggaagcagagttcgaa |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
42096883 |
ctcgcaaaggatctgctctggtaagagaaatccatgagaagcagagttcgaa |
42096934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 42096619 - 42096685
Alignment:
| Q |
1 |
ttagaggcacagaggttaagactgaatttgatgatgaggatgaaggcaaggtcgttcttgttgtgca |
67 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
42096619 |
ttagaggcacagaggttcagactgaatttgatgatgaggatgaacgcaaggtcattcttcttgtgca |
42096685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University