View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18503_low_42 (Length: 206)
Name: NF18503_low_42
Description: NF18503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18503_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 11 - 190
Target Start/End: Original strand, 29319983 - 29320166
Alignment:
| Q |
11 |
attattctatatatttatttagtattttatcttaattttcaattaatatagtaccccaaaaaagttcaattgatgttttttaatgaaatttagatgagtt |
110 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319983 |
attactctatatatatatttagtattttatcttaattttcaattaatatagtaccccaaaaaagttcaattgatgttttttaatgaaatttagatgagtt |
29320082 |
T |
 |
| Q |
111 |
gtgtctcaggaactcatcgtgg----ataaggattattgattctaacatgtcaaacatgtagctattttttgttttaatatatt |
190 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29320083 |
gtgtctcagggactcatcgtggatatataaggattattgattctaacatgtcaaacatgtagctattttttgttttaatatatt |
29320166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University