View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18504_high_10 (Length: 346)
Name: NF18504_high_10
Description: NF18504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18504_high_10 |
 | |
|
| [»] scaffold0693 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0693 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 54 - 203
Target Start/End: Original strand, 5350 - 5499
Alignment:
| Q |
54 |
tactatttttaattgtgtttcactctggattaaggaccttattttgaatgagatgcaatgagtaatttctcttcaannnnnnnaacaacaacttttatta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5350 |
tactatttttaattgtgtttcactctggattaaggaccttattttgaatgagatgcaatgagtaatttctcttcaatttttttaacaacaacttttatta |
5449 |
T |
|
| Q |
154 |
attaagaaacaataagtataagtggtattagacccatcaatgtgatcctt |
203 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5450 |
attaagcaacaataggtataagtggtattagacccatcaacgtgatcctt |
5499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 232 - 329
Target Start/End: Original strand, 5634 - 5731
Alignment:
| Q |
232 |
ctattagcgcatcaaagatgagaggaagttgtgagaactaagcatcagtgaagcatccttttgagtctctaatgacgcaatcgtaaaccctgatcatg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5634 |
ctattagcgcatcaaagatgagaggaagttgtcagaactaagcatcagtgaagcatccttttgagtctctaatgacgcaatcgtagaccctgatcatg |
5731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 4885 - 4934
Alignment:
| Q |
12 |
tcaggctattcactctcttgtgtctaaattatatgtttgtcttactattt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4885 |
tcaggctattcactctcttgtgtctaaattgtatgtttgtcttactattt |
4934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University