View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18504_low_21 (Length: 264)
Name: NF18504_low_21
Description: NF18504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18504_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 137 - 246
Target Start/End: Original strand, 33965641 - 33965751
Alignment:
| Q |
137 |
aatgtagaaaaatagaaagtattttttgg-ttacatactttgaatgtgatgttcttagcaatgaaataaggtgaattaactgcaaaagttgctgaaccat |
235 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33965641 |
aatgtagaaaaatagaaagtagtttttgggttacatactttgaatgtgatgttcttggcaatgaaataaggtgaattaactgcaaaagttgctgaaccat |
33965740 |
T |
|
| Q |
236 |
atgttcccaat |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
33965741 |
atgttcccaat |
33965751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 43077458 - 43077381
Alignment:
| Q |
165 |
gttacatactttgaatgtgatgttcttagcaatgaaataaggtgaattaactgcaaaagttgctgaaccatatgttcc |
242 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
43077458 |
gttacttactttgaatgtgatgttcttagcaatgaaataaggtgaattcactgcaaaagttgccgaaccataagttcc |
43077381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University