View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18504_low_28 (Length: 231)
Name: NF18504_low_28
Description: NF18504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18504_low_28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 33360854 - 33361067
Alignment:
| Q |
18 |
aggatcatggctgcaactgaaatttaaaaccttggcaatgttgggacccacatgtgaaattagtgatgctgtttagttgatatgtatgatttagagggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33360854 |
aggatcatggctgcaactgaaatttaaaaccttggcaatgttgggacccacatgtgaaattagtgatgctgttttgttgatatgtatgatttagagggag |
33360953 |
T |
|
| Q |
118 |
tgaggctatgtgagttgtgttgtgggagcaacttgggagtggaatggtgtttatggctggtgatagtttttaggattttcaagtataatttatgagtcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33360954 |
tgaggctatgtgagttgtgttgtgggagcaacttgggagtggaatggtgtttatggctggtgatagtttttaggattttcaagtataatttatgagtcca |
33361053 |
T |
|
| Q |
218 |
tctttgctccattt |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33361054 |
tctttgctccattt |
33361067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University