View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18504_low_29 (Length: 224)
Name: NF18504_low_29
Description: NF18504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18504_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 207
Target Start/End: Complemental strand, 3884795 - 3884600
Alignment:
| Q |
10 |
aaaaatatgtagcaagaaaggaaatatggtcatataaaatccacaaagattaacatcctggcactgaaacatacacttgaacccttatttccatagtttc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884795 |
aaaaaaatgtagcaagaaaggaaatatggtcatataaaatcca--aagattaacatcctggcattgaaacatacacttgaacccttatttccatagtttc |
3884698 |
T |
|
| Q |
110 |
acaaagcaatcatggctagctgaggcaatcaattcagcttcaggtgaatctgctagtccagcaattaaccccttgtgtgcagaaactgacactgttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884697 |
acaaagcaatcatggctagctgaggcaatcaattcagcttcgggtgaatctgctagtccagcaattaaccccttgtgtgcagaaactgacactgttct |
3884600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University