View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18505_high_13 (Length: 240)
Name: NF18505_high_13
Description: NF18505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18505_high_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 112 - 240
Target Start/End: Original strand, 40657035 - 40657163
Alignment:
| Q |
112 |
cttattgcagtggttgtgttgacgttgggcggggatcagcaatggtagacattgtctctgaacatgaatcggagaagacggttgaaatcgtcctcaaaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40657035 |
cttattgcagtggttgtgttgacgttgggcggggatcagcaatggtagacattgtctctgaacatgaatcggagaagacggttgaaatcgtcctcaaaac |
40657134 |
T |
 |
| Q |
212 |
catcggtccagctccaccttctcgtcttc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40657135 |
catcggtccagctccaccttctcgtcttc |
40657163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 40656928 - 40656976
Alignment:
| Q |
15 |
atatgtatgaatttatttataataatgacggttatttcatttatctaat |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40656928 |
atatgtatgaatttatttataataatgacggttatttcatctatctaat |
40656976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University