View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18505_high_15 (Length: 227)

Name: NF18505_high_15
Description: NF18505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18505_high_15
NF18505_high_15
[»] chr5 (1 HSPs)
chr5 (1-227)||(43164056-43164282)


Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43164056 - 43164282
Alignment:
1 catgagaaaataactaatagtcgttgatgataatttagtcaatgcattagaaacctaaaaacaaaatgtaaagggtttgaaaattagacaacaagctatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||    
43164056 catgagaaaataactaatagtcgttgatgataatttagtcaatgcattagaaacctaaaaacaaaatgtaaagggtttgaaaattagacaactggctatt 43164155  T
101 tgtgagtgactgaaaggttgccattaactgtttttgaggtcactcttgtgaaggatagaaatcttcatgtcgaattcgaggtcattcaacacacaaatga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43164156 tgtgagtgactgaaaggttgccattaactgtttttgaggtcactcttgtgaaggatagaaatcttcatgtcgaattcgaggtcattcaacacacaaatga 43164255  T
201 cattcagcgatcgaagagtagagatca 227  Q
    |||||||||||||||||| ||||||||    
43164256 cattcagcgatcgaagagcagagatca 43164282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University