View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18506_high_14 (Length: 280)
Name: NF18506_high_14
Description: NF18506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18506_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 1664475 - 1664216
Alignment:
| Q |
10 |
aagaatatttggatgaggtagaatgggatatctttcaatttaatcataggttctagtacaaatcaaatcctagaaatatagcagtattaaatct--taag |
107 |
Q |
| |
|
||||| ||||| ||||| ||||| | |||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||| |||| |
|
|
| T |
1664475 |
aagaacatttgaatgagatagaaagagatatctttcaatttaatcataggttctggtacaaatcaaatcctaaaaatataacagtattaaatctcttaag |
1664376 |
T |
|
| Q |
108 |
gaaaaattatatcatctattatgaacctatctaactcgaagaattaattttcacagttatttgcagaaaatatccgactcacacaacaaaaacacacact |
207 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1664375 |
gaaaaattatatcacctattataaacctatctaactcgaagaattaattttcacagttatttgcagaaaatattcgactcacacaacaaaaacacacact |
1664276 |
T |
|
| Q |
208 |
tcttctcttatctctttcctcatagagttctctctccgtcaccataaataggggcaatat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1664275 |
tcttctcttatctctttcctcatagagttctctctccgtcaccataaataggggcaatat |
1664216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University