View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18506_high_19 (Length: 204)
Name: NF18506_high_19
Description: NF18506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18506_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 17 - 180
Target Start/End: Original strand, 34842316 - 34842478
Alignment:
| Q |
17 |
attatgaagattgtacacgtttcaagatgtttgcaacctaattttaatttattttcaatgttatacgaaaaaatcgtgtttaggtaacaatttggttgan |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
34842316 |
attatgaagattgtatacgtttcaagatgtttgcaacataattttaatttattttcaacgttatacaaaaaaatcgtgtttagttaacaatttggttgat |
34842415 |
T |
 |
| Q |
117 |
nnnnnnngaagtcttaaccctatgattcctaaggacaagaatcatagtttataagatgaaatca |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34842416 |
ttttttt-aagtcttaaccctatgattcctaaggacaagaatcatagtttataagatgaaatca |
34842478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University