View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18507_high_13 (Length: 233)
Name: NF18507_high_13
Description: NF18507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18507_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 48569539 - 48569753
Alignment:
| Q |
1 |
agtattttcccgagcaggcagacttttttaacaaaattatcattagctgatgacggctgtttagttaaatgtatttcaaatgagtttatttaattacatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569539 |
agtattttcccgagcaggcagacttttttaacaaaattatcattggctgatgacggctgtttggttaaatgtatttcaaatgagtttatttaattacatc |
48569638 |
T |
 |
| Q |
101 |
aagaacatgaatgcaggtttatgagctcaacaatatgnnnnnnnattaaacgcaaattctggaggcttgtatatgatttagtggatgttggaaggctatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569639 |
aagaacatgaatgcaggtttatgagctcaacaaaatg-ttttttattaaacgcaaattctggaggcttgtatatgatttagtggatgttggaaggctatc |
48569737 |
T |
 |
| Q |
201 |
ttctgcacgtcatcag |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48569738 |
ttctgcacgtcatcag |
48569753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 10821475 - 10821422
Alignment:
| Q |
1 |
agtattttcccgagcaggcagacttttttaacaaaattatcattagctgatgac |
54 |
Q |
| |
|
|||||||||| ||||| || || ||||| |||||||| |||||||||||||||| |
|
|
| T |
10821475 |
agtattttccagagcaagctgagtttttaaacaaaatgatcattagctgatgac |
10821422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 36145913 - 36145966
Alignment:
| Q |
1 |
agtattttcccgagcaggcagacttttttaacaaaattatcattagctgatgac |
54 |
Q |
| |
|
|||||||||| ||||| || || ||||| |||||||| |||||||||||||||| |
|
|
| T |
36145913 |
agtattttcctgagcaagctgagtttttaaacaaaatgatcattagctgatgac |
36145966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University