View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18507_high_14 (Length: 229)
Name: NF18507_high_14
Description: NF18507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18507_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 25 - 213
Target Start/End: Original strand, 24064075 - 24064266
Alignment:
| Q |
25 |
attcaaagattgtttcaccaagatttgaactcaaataattgatgtgaatga---tgattatcaattttagggattaaatcacacaatcctataatttcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24064075 |
attcaaagattgtttcaccaagatttgaactcaaagaattgatgtgaatgatgatgattatcaattttagggattaaatcactcaatcctataatttcaa |
24064174 |
T |
 |
| Q |
122 |
tgattaaattggtaatttactccaattttaagaattcaaggactatactaaccttggaaaactgctttctatcattcatagaattgcatatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24064175 |
tgattaaattggtaatttactccaattttaagaattcaaggactatactaaccttggaaaactgctttctatcattcatagaattgcatatt |
24064266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 24016737 - 24016783
Alignment:
| Q |
167 |
tactaaccttggaaaactgctttctatcattcatagaattgcatatt |
213 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
24016737 |
tacttaccttagaaaactgctttctgtcattcatggaattgcatatt |
24016783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University