View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18507_high_6 (Length: 334)
Name: NF18507_high_6
Description: NF18507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18507_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 31 - 334
Target Start/End: Complemental strand, 37032813 - 37032510
Alignment:
| Q |
31 |
aattgtatagattaattcgtcgaggtaatttagatttatttaacggtaagttttatgaaaatgtgtaaaacaaaagactaagaaaaaatgttaattgggg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032813 |
aattgtatagattaattcgtcgaggtaatttagatttatttaacggtaagttttatgaaaatgtgtaaaacaaaagactaagaaaaaatgttaattgggg |
37032714 |
T |
 |
| Q |
131 |
tctcaccttgtgaatggttcccaagagtgatgacttgtttctgttatctctaaccctgagctgccggagcacagacttccggctcactgttgccggcaaa |
230 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032713 |
tttcaccttgtgaatggttcccaagagtgatgacttgtttctgttatctctaaccctgagctgccggagcacagacttccggctcactgttgccggcaaa |
37032614 |
T |
 |
| Q |
231 |
agcgacctcctttccacgacggctgtgctgccgtttgaagagctctcagattgattttccttcatctttttgcggcgtttgataagacgtaactctttct |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032613 |
agcgacctcctttccacgacggctgtgctgccgtttgaagagctctcagattgattttccttcatctttttgcggcgtttgataagacgtaactctttct |
37032514 |
T |
 |
| Q |
331 |
tctc |
334 |
Q |
| |
|
|||| |
|
|
| T |
37032513 |
tctc |
37032510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University