View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18507_high_7 (Length: 279)
Name: NF18507_high_7
Description: NF18507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18507_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 261
Target Start/End: Complemental strand, 3625623 - 3625571
Alignment:
| Q |
209 |
aaagaaagcagaaatgattgtttttaggaattatgtttccgctgattttgttt |
261 |
Q |
| |
|
||||||| |||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
3625623 |
aaagaaaacagaaatgattgttttcacgaattatgtttccgctgattttgttt |
3625571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 3625694 - 3625654
Alignment:
| Q |
117 |
ggaacaatagagggcataagtctatctcccaggatacattt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3625694 |
ggaacaatagagggcataagtctatctcccaggatacattt |
3625654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University