View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18507_low_16 (Length: 240)
Name: NF18507_low_16
Description: NF18507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18507_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 44032635 - 44032856
Alignment:
| Q |
19 |
ggtgcgaatcccacattaattaaaaattgctacttgttataagattggatgaacacaactcctcttaccgactagattcgctgtgaagaaagnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44032635 |
ggtgcgaatcccacattaattaaaaattgctacttgttataagattggatgaacacaactcctcttaccgactagattcgctgtgaagaaagaaaaaaaa |
44032734 |
T |
 |
| Q |
119 |
ncaggcagaggctggcatatattgcttaagtttctgtcatgtcaaaaacacaggtgggttgtcaatttttcatgtactactgcttactccatccgattca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
44032735 |
acaggcagaggctggcatatattgcttaagtttctgtcatgtcaaaaacacaggtgggttgtcaatttctcatgcactactgcttactccatccgattca |
44032834 |
T |
 |
| Q |
219 |
gcatgtaaaagaaaattggatc |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44032835 |
gcatgtaaaagaaaattggatc |
44032856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University