View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18508_low_17 (Length: 247)

Name: NF18508_low_17
Description: NF18508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18508_low_17
NF18508_low_17
[»] chr3 (1 HSPs)
chr3 (16-231)||(47835531-47835746)


Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 47835746 - 47835531
Alignment:
16 ataaaagaggtccaatccattgttacggaacaccgtagatattaagaaacactatgtatatgatataaatgaatgtcaatctatattcttccaaaaggtg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47835746 ataaaagaggtccaatccattgttacggaacaccgtagatattaagaaacactatgtatatgatataaatgaatgtcaatctatattcttccaaaaggtg 47835647  T
116 tgtccgatgggatggaggatgcttgggaataaagaatcctgaggctttcaatatagctttactggcaatgtggagatggaggatgcttgttgatacagat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47835646 tgtccgatgggatggaggatgcttgggaataaagaatcctgaggctttcaatatagctttactggcaatgtggagatggaggatgcttgttgatacagat 47835547  T
216 agcatacggcataact 231  Q
    ||||||||||||||||    
47835546 agcatacggcataact 47835531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University