View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18509_low_8 (Length: 356)
Name: NF18509_low_8
Description: NF18509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18509_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 4803225 - 4802979
Alignment:
| Q |
1 |
taatgtataccaagttttaataacttttggttttgcttttgcaggttagaagagaaaagattagtgaacgaatgaggttgcttcaagaacttgttccggg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4803225 |
taatgtataccaagttttaacaacttttggttttgcttttgcaggttagaagagaaaagattagtgaacgaatgaggttgcttcaagaacttgttccggg |
4803126 |
T |
 |
| Q |
101 |
atgcaacaaggtagggattggtttagatgattgtgttaaatggtttcttatgattcatcataacttattacttatttggtgacacactgattgatatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4803125 |
atgcaacaaggtagggattggtttagatgattgtgttaaatggtttcttatgattcatcataacttataacttatttggtgacacactgattgatatatg |
4803026 |
T |
 |
| Q |
201 |
tctcagtagattaatttcattttctctttgttaatttttctgatgat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4803025 |
tctcagtagattaatttcattttctctttgttaatttttctgatgat |
4802979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 113
Target Start/End: Original strand, 27329699 - 27329761
Alignment:
| Q |
51 |
agagaaaagattagtgaacgaatgaggttgcttcaagaacttgttccgggatgcaacaaggta |
113 |
Q |
| |
|
||||||||||| |||||| |||||| ||| |||||||| ||||| || ||||||||||||||| |
|
|
| T |
27329699 |
agagaaaagatcagtgaaagaatgaagtttcttcaagatcttgtacctggatgcaacaaggta |
27329761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University