View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1850_high_13 (Length: 290)
Name: NF1850_high_13
Description: NF1850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1850_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 72 - 228
Target Start/End: Complemental strand, 12438404 - 12438248
Alignment:
| Q |
72 |
acatgaaagtaccataacatattctttcagcaaatgcaataaagatcacatgaaaacatctctttagcatattataaaacttgaataatgcaatataatt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12438404 |
acatgaaagtaccataacatattctttcagcaaatgcaataaagatcacatgaaaacatctctttagcatattataaaacttgaacaatgcaatataatt |
12438305 |
T |
|
| Q |
172 |
acatttaattggttacattgcatcatgatattttcccttccacatattatgaaggtt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12438304 |
acatttaattggttacattgcatcatgatattttcccttccacatattatgaaggtt |
12438248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University