View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1850_high_15 (Length: 245)
Name: NF1850_high_15
Description: NF1850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1850_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 5 - 229
Target Start/End: Original strand, 36503058 - 36503291
Alignment:
| Q |
5 |
gttttcaataggaagatcggttatggaagctatccctgacaaatttggttgaataaattaagtctcagtagaggcttctaaaagctacctttgtgacaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36503058 |
gttttcaataggaagatcggttatggaagctatccctgacaaatttggttgaataaattaagtctcagtagaggcttctaaaagctacctttgtgacaac |
36503157 |
T |
 |
| Q |
105 |
aaattggtagaaagacatgatgtagatatagtagnnnnnnnnatttgttattgaactatacgtttttatttgatg----------atttactcttatact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36503158 |
aaattggtagaaagacatgatgtagatatagtag-ttttttaatttgttattgaactatacgtttttatttgatgtagtgttccaatttactcttatact |
36503256 |
T |
 |
| Q |
195 |
acaggctatacgtgttctctacagttgtaataact |
229 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36503257 |
acaggctatacatgttctctacagttttaataact |
36503291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University