View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1850_low_11 (Length: 313)
Name: NF1850_low_11
Description: NF1850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1850_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 3308175 - 3307866
Alignment:
| Q |
1 |
gaactcctttcctcattcatttcatattgccatttctaattatccttgttctcgactgcttccttaaagatattcgattcctacttgcatattttcaacc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308175 |
gaactcttttcctcattcatttcatattgccatttctaattatcattgttctcgactgcttccttaaagatattcgattcctacttgcatattttcaacc |
3308076 |
T |
 |
| Q |
101 |
acacttagatcataacacacaaggtctttatagccataccactttggtgcaataattttcccattttctccatgatctcttgccaactgatagtcatgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3308075 |
acacttagatcataacacacaaggtctttatagccataccactttggtgcaataattttcccattttctcc---atctcttgccaactgatagtcatgag |
3307979 |
T |
 |
| Q |
201 |
ccacagttggttgtcttactatggaacttgctggaggaatactatcctcatttccatacctggtcttactagtgggaaactcatcctcaaacacatacaa |
300 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3307978 |
ccactgttggttgtcttactatagaacttgctggaggaatactatcctcatttccatacctggtcttactagtgggaaactcatcctcaaacacatacaa |
3307879 |
T |
 |
| Q |
301 |
gtctttgtacttc |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3307878 |
gtctttgtacttc |
3307866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University