View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1850_low_15 (Length: 282)
Name: NF1850_low_15
Description: NF1850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1850_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 5 - 266
Target Start/End: Original strand, 21838612 - 21838873
Alignment:
| Q |
5 |
gagtgagatgaacatatgtaatatctaggaaatgttgagagataggattgtaaaaatttccatatttttcatcagaactctagctgccaaagaaaataca |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
21838612 |
gagtgatatgaacatatgtaatatctaggaaatgttgagagataggattgtaaaaatttccatattttttatcagaactctagctgccaaaggaaataca |
21838711 |
T |
 |
| Q |
105 |
aaaccgagtttatgcatatttgattttaaccgttcaatttcaaattaacagtcgaaatcgtgtagcaacatgatttttcttacaagtgaaaccccggttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
21838712 |
aaaccgagtttatgcatatttgattttaaccgttcaatttcaaattaacagtcgaaatcgtgtaacagcatgatttttcttacaagtgaaaccccggttt |
21838811 |
T |
 |
| Q |
205 |
accctgcattattgctcttagagtctgctcaaatgcacttatacctactgaccacatgtagt |
266 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21838812 |
accctgcattattgttcttagagtctgctcaaatgcacttatacctactgaccacatgtagt |
21838873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University