View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1850_low_17 (Length: 233)
Name: NF1850_low_17
Description: NF1850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1850_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 23056125 - 23056327
Alignment:
| Q |
17 |
attgtattatttcatcaaccttgccaccaaacacgggttaagtttgtatcttatataaggatttatccatttatatatgagtatttgtatttatatgttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23056125 |
attgtattatttcatcaaccttgccaccaaacacgggttaagtttgtatcttatataaggatttatccatttatatatgagtatttgtatttatatgttc |
23056224 |
T |
 |
| Q |
117 |
ttgcattttgagagctattaaatcgtaatttgattttccttttctcactgattatagaagcaagaaatatggatgaaacaaagttgaaattcaaagatca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23056225 |
ttgcattttgagagctattaaatcgtaatttgcttttcctttcctcactgattatagaagcaagaaatatggatgaaacaaagttgaaattcaaagatca |
23056324 |
T |
 |
| Q |
217 |
aag |
219 |
Q |
| |
|
||| |
|
|
| T |
23056325 |
aag |
23056327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University