View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18510_high_11 (Length: 309)
Name: NF18510_high_11
Description: NF18510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18510_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 18 - 302
Target Start/End: Complemental strand, 8210606 - 8210317
Alignment:
| Q |
18 |
taaactcttctccatttgtataagaacgaaattagggatggtaaaataggtcgagtctatcgaaccaatccgtttaatatgttattttaaataaattgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||| |
|
|
| T |
8210606 |
taaactcttctccatttgtataagaacgaaattagagatggtaaaataggtcgagtctatcgaaccaatcagtttaatctgttattttaaataaaccgag |
8210507 |
T |
|
| Q |
118 |
ttgatgttttaaactcaatctcttaagttggttcactctaactagatagaaaacgcatggtggaatcagtatggctggactagcatgcaagctagtataa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||| ||| ||||||||| ||| ||||||||||| ||| |
|
|
| T |
8210506 |
ttgatgttttaaactcaatctcttaagttggttcactctaattagatagaaaaggcagggtggaaatagtgtggctggaccagcctgcaagctagtgtaa |
8210407 |
T |
|
| Q |
218 |
aaaataatcatttttatatggnnnnnnnat-----agaaataatatgaatcacaacatcaaatcatttaatcattagcccacctttgcta |
302 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8210406 |
aaaataatcatttttatatatattttttttttttgagaaataatatgaatcacaacatcaaatcatttaatcattagcccacctttgcta |
8210317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University