View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18510_high_15 (Length: 266)
Name: NF18510_high_15
Description: NF18510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18510_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 7092910 - 7093147
Alignment:
| Q |
15 |
agatttaaagtaaattttgatatatgaggcctttttattggcatatgaggtcttttttgttcgtaggccttaagcgagggctttagtggctttacctttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
7092910 |
agatttaaagtaaattttgatatatgaggcctttttatcggcatataaggtcttttttgtttgtaggccttaaacgagggttttagtggctttacctttg |
7093009 |
T |
|
| Q |
115 |
aaccggctctgcgtatgatcggttagaccttgtgttagggattactacaaaacttgaacaaatagaagaagataacaatgattgattgtgcataaatttt |
214 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7093010 |
aaccggccctgcgtatgatcggttagaacttgtgttagggattactacaaaacttgaacaaatagaagaagataataatgattgattgtgcataaatttt |
7093109 |
T |
|
| Q |
215 |
aaaacgtatgtgaatacattgattcgtctccattagtt |
252 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
7093110 |
aaaacgtatgtgaacacattgattcatctccattagtt |
7093147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 30484177 - 30484230
Alignment:
| Q |
20 |
taaagtaaattttgatatatgaggcc-tttttattggcatatgaggtctttttt |
72 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
30484177 |
taaagcaaattttgatatatgagtccttttttatcggcatatgaggtctttttt |
30484230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 67 - 110
Target Start/End: Complemental strand, 19839470 - 19839427
Alignment:
| Q |
67 |
ttttttgttcgtaggccttaagcgagggctttagtggctttacc |
110 |
Q |
| |
|
|||||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
19839470 |
ttttttattggtaggcctaaagcgagggctttagtggctttacc |
19839427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 106
Target Start/End: Original strand, 35963965 - 35964005
Alignment:
| Q |
66 |
cttttttgttcgtaggccttaagcgagggctttagtggctt |
106 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
35963965 |
cttttttgttggtaagcctaaagcgagggctttagtggctt |
35964005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University