View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18510_low_18 (Length: 237)

Name: NF18510_low_18
Description: NF18510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18510_low_18
NF18510_low_18
[»] chr2 (1 HSPs)
chr2 (1-230)||(7093186-7093416)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 7093186 - 7093416
Alignment:
1 cctttatgatagtttaaaattttggacgtggcttgcacactcatatcaaccttatcgatcaataatagcttatagaataaaatttcttcgattactcttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
7093186 cctttatgatagtttaaaattttggacgtggcttgcacactcatatcaatcttatcgatcaataatagcttatagaataaaatttcttcgattactcttg 7093285  T
101 tgcactatnnnnnnnnnnnntggttcatcgaaacaatgtaatcattgtgtttattcataaacaaactctttc-actttcaagagattgtttctcttcacc 199  Q
    ||||||||            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
7093286 tgcactataaaaaagaaaaatggttcatcgaaacaatgtaatcattgtgtttattcataaacaaactctttcaactttcaagagattgtttctcttcacc 7093385  T
200 aaaagaaatggtttagtattacttttcagta 230  Q
    ||| ||||||||| |||||||||||||||||    
7093386 aaaggaaatggttgagtattacttttcagta 7093416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University