View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18510_low_18 (Length: 237)
Name: NF18510_low_18
Description: NF18510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18510_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 7093186 - 7093416
Alignment:
| Q |
1 |
cctttatgatagtttaaaattttggacgtggcttgcacactcatatcaaccttatcgatcaataatagcttatagaataaaatttcttcgattactcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7093186 |
cctttatgatagtttaaaattttggacgtggcttgcacactcatatcaatcttatcgatcaataatagcttatagaataaaatttcttcgattactcttg |
7093285 |
T |
 |
| Q |
101 |
tgcactatnnnnnnnnnnnntggttcatcgaaacaatgtaatcattgtgtttattcataaacaaactctttc-actttcaagagattgtttctcttcacc |
199 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7093286 |
tgcactataaaaaagaaaaatggttcatcgaaacaatgtaatcattgtgtttattcataaacaaactctttcaactttcaagagattgtttctcttcacc |
7093385 |
T |
 |
| Q |
200 |
aaaagaaatggtttagtattacttttcagta |
230 |
Q |
| |
|
||| ||||||||| ||||||||||||||||| |
|
|
| T |
7093386 |
aaaggaaatggttgagtattacttttcagta |
7093416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University