View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18510_low_5 (Length: 367)

Name: NF18510_low_5
Description: NF18510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18510_low_5
NF18510_low_5
[»] chr7 (5 HSPs)
chr7 (16-332)||(31225612-31225928)
chr7 (279-331)||(22851819-22851871)
chr7 (281-332)||(29903466-29903517)
chr7 (242-332)||(31971783-31971873)
chr7 (281-314)||(11378788-11378821)
[»] chr8 (1 HSPs)
chr8 (69-332)||(41309920-41310182)
[»] chr4 (1 HSPs)
chr4 (112-190)||(24189903-24189981)
[»] chr1 (1 HSPs)
chr1 (117-189)||(9074501-9074573)
[»] chr3 (1 HSPs)
chr3 (281-329)||(37158687-37158735)
[»] chr2 (1 HSPs)
chr2 (242-314)||(14436934-14437005)


Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 332
Target Start/End: Original strand, 31225612 - 31225928
Alignment:
16 cattagcaaggcctgttgtgttggnnnnnnnncttttctgttttggctaggcctagggagcctcttgggttctgtgcttggggttgcgggtatgcttgtg 115  Q
    ||||||||||||||||||||||||        |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
31225612 cattagcaaggcctgttgtgttggttttttttcttttctgttttggctaggcctagggagccccttgggttctgtgcttggggctgcgggtatgcttgtg 31225711  T
116 cctagtttgagctatggctgtgtaattgggtggcgattgtatcggattacaggctcataactcgctactgtcacagcctttagaatccttgtggagttgc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31225712 cctagtttgagctatggctgtgtaattgggtggcgattgtatcggattacaggctcataactcgctactgtcacagcctttagaatccttgtggagttgc 31225811  T
216 tagttggttttgttgttttgggcttcggtgtaccgtctatatatggcaccttttatattgttatgtcgtccataccttgcgtcttgcggagttggcgtta 315  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
31225812 tagttggttttgttggtttgggcttcggtgtaccgtctatatatggcaccttttatattgttatgtcgtccataccttgcgtcttgcggggttggcgtta 31225911  T
316 ataaattttgccgattc 332  Q
    |||||||||||||||||    
31225912 ataaattttgccgattc 31225928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 279 - 331
Target Start/End: Original strand, 22851819 - 22851871
Alignment:
279 tgtcgtccataccttgcgtcttgcggagttggcgttaataaattttgccgatt 331  Q
    ||||||||||| |||||||||||||| || |||||||||||||||| ||||||    
22851819 tgtcgtccatatcttgcgtcttgcggggtcggcgttaataaatttttccgatt 22851871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 29903466 - 29903517
Alignment:
281 tcgtccataccttgcgtcttgcggagttggcgttaataaattttgccgattc 332  Q
    |||||||| ||||||| ||||||| ||||||| |||||||||||||||||||    
29903466 tcgtccattccttgcgccttgcggggttggcgctaataaattttgccgattc 29903517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 242 - 332
Target Start/End: Complemental strand, 31971873 - 31971783
Alignment:
242 ggtgtaccgtctatatatggcaccttttatattgttatgtcgtccataccttgcgtcttgcggagttggcg-ttaataaattttgccgattc 332  Q
    ||||||||||||||||  |||||| ||| |||  || | |||||||||||||||||||||||| | ||||| |||||||  |||||||||||    
31971873 ggtgtaccgtctatatgcggcaccatttgtatc-ttgtttcgtccataccttgcgtcttgcggggatggcgtttaataatatttgccgattc 31971783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Complemental strand, 11378821 - 11378788
Alignment:
281 tcgtccataccttgcgtcttgcggagttggcgtt 314  Q
    |||||||||||||||||||||||| |||||||||    
11378821 tcgtccataccttgcgtcttgcggggttggcgtt 11378788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 69 - 332
Target Start/End: Complemental strand, 41310182 - 41309920
Alignment:
69 tagggagcctcttgggttctgtgcttggggttgcgggtatgcttgtgcctagtttgagctatggctgtgtaattgggtggcgattgtatcggattacagg 168  Q
    ||||| |||| ||||||||| || |||||| || |||| || |||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||    
41310182 tagggtgccttttgggttctttgtttggggctgagggtctgtttgtgcctagtttgagctatggctgtgtaattcggtggccattgtaccggattacagg 41310083  T
169 ctcataactcgc--tactgtcacagcctttagaatccttgtggagttgctagttggttttgttgttttgggcttcggtgtaccgtctatatatggcacct 266  Q
    ||||||||| ||  |||||||||||  ||| |  |||||||||||     |||  ||| | | |||||||| || |||||||  |||||||  |||| ||    
41310082 ctcataacttgctatactgtcacagtttttgggttccttgtggag----gagtctgttatttcgttttggggttgggtgtactctctatatgcggcatct 41309987  T
267 tttatattgttatgtcgtccataccttgcgtcttgcggagttggcg-ttaataaattttgccgattc 332  Q
    ||| |||  ||||||| || ||||||| |||||||||  ||||||| |||||||||||||| |||||    
41309986 tttgtatctttatgtcatctataccttacgtcttgcgaggttggcgtttaataaattttgctgattc 41309920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 112 - 190
Target Start/End: Original strand, 24189903 - 24189981
Alignment:
112 tgtgcctagtttgagctatggctgtgtaattgggtggcgattgtatcggattacaggctcataactcgctactgtcaca 190  Q
    |||| |||||||||||||||||||||||||| ||||| ||||  | |||||||||||| ||||||| ||| ||||||||    
24189903 tgtgactagtttgagctatggctgtgtaatttggtggtgatttgaccggattacaggcacataacttgcttctgtcaca 24189981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 189
Target Start/End: Complemental strand, 9074573 - 9074501
Alignment:
117 ctagtttgagctatggctgtgtaattgggtggcgattgtatcggattacaggctcataactcgctactgtcac 189  Q
    ||||||| |||||||||| ||||||| ||||| | | | | |||||||||||||||||| | |||||||||||    
9074573 ctagttttagctatggctttgtaattcggtggtgttagaaccggattacaggctcataatttgctactgtcac 9074501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 329
Target Start/End: Original strand, 37158687 - 37158735
Alignment:
281 tcgtccataccttgcgtcttgcggagttggcgttaataaattttgccga 329  Q
    |||||||||||||||||||||||| | ||||||| ||||  ||||||||    
37158687 tcgtccataccttgcgtcttgcggggatggcgtttataatatttgccga 37158735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 14437005 - 14436934
Alignment:
242 ggtgtaccgtctatatatggcaccttttatattgttatgtcgtccataccttgcgtcttgcggagttggcgtt 314  Q
    ||||||||||||||||  |||||| ||| |||  || | |||||||||||||||||||||||| | |||||||    
14437005 ggtgtaccgtctatatgcggcaccatttgtatc-ttgtttcgtccataccttgcgtcttgcggggatggcgtt 14436934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University