View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18510_low_9 (Length: 331)
Name: NF18510_low_9
Description: NF18510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18510_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 14 - 316
Target Start/End: Original strand, 3318501 - 3318799
Alignment:
| Q |
14 |
atatcatacgctagaagaagatagagcatatattttgtatcacgatgaatttgtcagaatcacagtgttccaccttaatacaaatcatacacttaata-t |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||| | |
|
|
| T |
3318501 |
atatcatacgctagaagaagatagagcatatattttatatcacgatggatttgtcagaatcaca-----ccaccttgatacaaatcatacacttaataat |
3318595 |
T |
 |
| Q |
113 |
atagggtttgatttactatttgaagaaggaggagattttgtagattagttattggatttttataaaatgtggggggtttatagtgatgtgtagaggatgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3318596 |
atagggtttgatttactatttgaagaaggaggagattttgtagattagttatcggatttttataaaatgtggggggtttatagtgatgtgtagaggatgg |
3318695 |
T |
 |
| Q |
213 |
tgaagatatatgtggcaatgtgtttggtttctctactctctatattttctcctcttttatttcctcttctccaatgtgtttggttactatttatactaga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3318696 |
tgaagatatatgtggcaatgtgtttggtttctctactctctatattttctcctcttttatttcctcttctccaatgtgtttggttactatttatactaga |
3318795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 113 - 279
Target Start/End: Original strand, 3310799 - 3310973
Alignment:
| Q |
113 |
atagggtttgatttactatttgaagaaggaggagattttgta---gattagttattggatttttataaaatgtggggg-----gtttatagtgatgtgta |
204 |
Q |
| |
|
|||||||||| |||||||| ||||| || |||||| |||||| |||||| ||| | | |||||| |||| |||||| ||| || |||||||||| |
|
|
| T |
3310799 |
atagggtttggtttactatatgaagtagtaggagagtttgtatgagattagatatcgaagttttattaaatctgggggccggggttcatggtgatgtgta |
3310898 |
T |
 |
| Q |
205 |
gaggatggtgaagatatatgtggcaatgtgtttggtttctctactctctatattttctcctcttttatttcctct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
3310899 |
gaggatggtgaagatatatgtggcaatgtgtttggtttcactactctctatattttctcttctcttatttcctct |
3310973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University