View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18511_high_13 (Length: 258)

Name: NF18511_high_13
Description: NF18511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18511_high_13
NF18511_high_13
[»] chr1 (1 HSPs)
chr1 (17-245)||(9975483-9975708)
[»] chr7 (1 HSPs)
chr7 (17-67)||(7113053-7113103)
[»] chr6 (1 HSPs)
chr6 (32-60)||(19855786-19855814)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 9975483 - 9975708
Alignment:
17 agaagttgtatgagatttgtgagtgtgcatctgaatctctgttgcctgtataattattttgtggaaacatggaatattagttaatggttggtttggtacg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9975483 agaagttgtatgagatttgtgagtgtgcatctgaatctctgttgcctgtataattattttgtggaaacatggaatattagttaatggttggtttggtacg 9975582  T
117 ttatcattgtnnnnnnnnnnnnnnngatacaaatcatatggaagtgttggaagtatttaatatataatacatgataaaacataagt-nnnnnnnntaata 215  Q
    ||||||||||               |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||          ||||    
9975583 ttatcattgt----aaaaacaattagatacaaatcatatggaagtgttggaagtatttaatatataatatatgataaaacataagtaaaaaaaaaaaata 9975678  T
216 tgaacatgataatagaggctacttatccat 245  Q
    |||||||||||||| |||||||||||||||    
9975679 tgaacatgataatataggctacttatccat 9975708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 7113103 - 7113053
Alignment:
17 agaagttgtatgagatttgtgagtgtgcatctgaatctctgttgcctgtat 67  Q
    ||||||||||||  ||||||||||||||||||||||||| ||||| |||||    
7113103 agaagttgtatggaatttgtgagtgtgcatctgaatctccgttgcttgtat 7113053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 60
Target Start/End: Complemental strand, 19855814 - 19855786
Alignment:
32 tttgtgagtgtgcatctgaatctctgttg 60  Q
    |||||||||||||||||||||||||||||    
19855814 tttgtgagtgtgcatctgaatctctgttg 19855786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University