View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18511_high_9 (Length: 291)
Name: NF18511_high_9
Description: NF18511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18511_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 39678640 - 39678461
Alignment:
| Q |
19 |
attctgggctcttagcgtccctgcaaaattccttatatagaaaaataaactaagcatgcactttctgtatttgatgcactggtttgcttttttgatcatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39678640 |
attctgggctcttagcgtccctgcaaaattccttatatagaaaaataaactaagcatgcactttctgtattcgatgcactggtttgcttttttgatcatg |
39678541 |
T |
 |
| Q |
119 |
aactgatttattctcaaggtgtatagaggaccttcagataaccacggtgtgctgcagaaatcgaatcaaatccctatttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678540 |
aactgatttattctcaaggtgtatagaggaccttcagataaccacggtgtgctgcagaaatcgaatcaaatccctatttg |
39678461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 291
Target Start/End: Complemental strand, 39678326 - 39678293
Alignment:
| Q |
258 |
tttataatattgtttcgatcatattagaatatct |
291 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
39678326 |
tttataatattatttcgatcatattagaatatct |
39678293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University