View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18512_high_10 (Length: 351)
Name: NF18512_high_10
Description: NF18512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18512_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 346
Target Start/End: Complemental strand, 33273469 - 33273147
Alignment:
| Q |
18 |
gtacattactatcttcgatattactgagaatcgcagttaaatgtgtgtttaagcaatcatgattgtgttgcagtcgcggagacatacaaaccttgattgc |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273469 |
gtacattactatcttcgatattacagagaatcgcagttaaatgtgtgtttatgcaatcatgattgtgttgcagtcgcggagacatacaaaccttgattgc |
33273370 |
T |
 |
| Q |
118 |
ggtcacggtaatttcttttaaaaccctgcctatttgacaaaataagcaggctggaatcttggagctaaaatcaaaatgattgttcacaccgcgttactcg |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273369 |
ggt------aatttcttttaaaaccctgcctatttgacaaaataagcaggctggaatcttggagctaaaatcaaaatgattgttcacaccgcgttactcg |
33273276 |
T |
 |
| Q |
218 |
gataaacaatagaattactcttaaatttacttcatgcaagagtcaagtactatgctttatttattatttttgttattaattgatnnnnnnngattgctgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| | |
|
|
| T |
33273275 |
gataaacaatagaattactcttaaatttacttcatgcaagagtcaagtactatgctttatttattatttttgttattaattaattaaaaaagattgctat |
33273176 |
T |
 |
| Q |
318 |
atcttataagattttggtcctatgcttct |
346 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |
|
|
| T |
33273175 |
atcttataagattttggtccaatgtttct |
33273147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University