View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18512_low_23 (Length: 291)
Name: NF18512_low_23
Description: NF18512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18512_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 284
Target Start/End: Original strand, 33272901 - 33273176
Alignment:
| Q |
9 |
gaagaaaattacaaagtgagtttataggtccacaagacatgtgacatgaaagtgatgcctttgaactgtgagcaaaatgttaccatatccttggatgtaa |
108 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272901 |
gaagaatattacaaaatgagtttctaggtccacaagacatgtgacatgaaagtgatgcctttgaactgtgagcaaaatgttaccatatccttggatgtaa |
33273000 |
T |
|
| Q |
109 |
aaagtaatttaatctcagattctcagtcctatcacttaatcttcaaatcaatcaaggattttggagttaatcatatctgttatgcagccatatatttgat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33273001 |
aaagtaatttaatctcagattctcagtcctatcacttaatcttcaaatcaatcaaggattttggagttaatcatatctgttatgtagccatatatttgat |
33273100 |
T |
|
| Q |
209 |
tgagatatcatggctaatgtacatgaccaaaaggcatgaattatgcagaaacattggaccaaaatcttataagata |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273101 |
tgagatatcatggctaatgtacatgaccaaaaggcatgaattatgcagaaacattggaccaaaatcttataagata |
33273176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University