View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18512_low_31 (Length: 237)
Name: NF18512_low_31
Description: NF18512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18512_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 1092476 - 1092270
Alignment:
| Q |
16 |
tatttctgttggaaatatataacttgatttatactatttgggcatcgttcatatgctccatgatagttttgttctctattttcctcgctttaatttgaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1092476 |
tatttctgttggaaatatataacttgatttatactatttgggcatcgttcatatgctccatgatagttttgttctctattttcctcgctttaatttgaat |
1092377 |
T |
|
| Q |
116 |
ttgtttacttattttatttatgtgcgataggttgagctttgcaaagatgatgagtttcttgtgatagcttgtgatgggatatggtatgttatatagatga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1092376 |
ttgtttacttattttatttatgtgcgataggttgagctttgcaaagatgatgagtttcttgtgatagcttgtgatgggatatggtatgttatatagatga |
1092277 |
T |
|
| Q |
216 |
caaatgt |
222 |
Q |
| |
|
||||||| |
|
|
| T |
1092276 |
caaatgt |
1092270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University