View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18513_high_14 (Length: 227)
Name: NF18513_high_14
Description: NF18513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18513_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 219
Target Start/End: Original strand, 37553962 - 37554175
Alignment:
| Q |
7 |
caaatttgataatattcatcgtgcttctgtcaacaaacaacgttctgtgtctttggcagaattcaaaacttctgcaattgctgaacctgcggaggtaacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37553962 |
caaatttgataatattcatcgtgcttctgtcaacaaacaacgttctgtgtctttggcagaattcaaaacttctgcaattgctgaacctgcagaggtaacc |
37554061 |
T |
 |
| Q |
107 |
attttatcatattttccttttcataaagtagcaaataattataacattataatattaattgttatatgattagtaa-ttagtattgctgaacgtgttctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37554062 |
attttatcatattttccttttcataaagtagcaaataattataacattataatattaattgttatatgattagtaatttagtattgctgaacgtgttctt |
37554161 |
T |
 |
| Q |
206 |
tcttcttaaatttg |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37554162 |
tcttcttaaatttg |
37554175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University