View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18513_low_15 (Length: 254)
Name: NF18513_low_15
Description: NF18513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18513_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 238
Target Start/End: Original strand, 44533320 - 44533537
Alignment:
| Q |
21 |
tgcagctgttattgcatttctccaaaaattgtctggacaaccaccacctcaaccaccgctagcaccagagctgtctgcgtgtcagacagctctcgcatca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
44533320 |
tgcagctgttattgcatttctccaaaaattgtctggacaaccaccacctcaaccaccgctagcaccagagctgtctgtgtgtcagacagctctggcatca |
44533419 |
T |
|
| Q |
121 |
caagttcaaacacaacaactagtgataccaaacaacaacattgttgaatttcaaaatatgaataatggttacaaaagtggtaacggtggcgcttctcctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533420 |
caagttcaaacacaacaactagtgataccaaacaacaacattgttgaatttcaaaatatgaataatggttacaaaagtggtaacggtggcgcttctcctt |
44533519 |
T |
|
| Q |
221 |
ctccatcaaggtggccaa |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44533520 |
ctccatcaaggtggccaa |
44533537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University