View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18513_low_18 (Length: 241)
Name: NF18513_low_18
Description: NF18513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18513_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 36012341 - 36012556
Alignment:
| Q |
18 |
agtgaagtctcccatcgggataaattcgcgaggtatagcacctcccttttgctatatatggtggttgaactttttatattttgcattaaattaannnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36012341 |
agtgaagtctcccatcgggataaattcgcgaggtatagcacctcccttttgctatatatggtggttgaactttttatattttgcattaaattaatttttt |
36012440 |
T |
|
| Q |
118 |
nngttcgttaaagttactttaggcttcacttcaacctcttaannnnnnncattacgttttgttcatttaggttaccaaagttaaatactttgatctcaag |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36012441 |
ttgttcgtt-aagttactttaggcttcacttcaacctcttaatttttttcattacgttttgttcatttaggttaccaaagttaaatactttgatctcaag |
36012539 |
T |
|
| Q |
218 |
aatatctttcgttctag |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36012540 |
aatatctttcgttctag |
36012556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University