View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18514_low_20 (Length: 206)
Name: NF18514_low_20
Description: NF18514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18514_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 117 - 172
Target Start/End: Original strand, 26565580 - 26565635
Alignment:
| Q |
117 |
tgttgcacccctttttcgaataatacttgatatattggtcttgcatttgataaata |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26565580 |
tgttgcacccctttttcgaataatacttgatatattggtcttgcatttgatgaata |
26565635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 192
Target Start/End: Original strand, 26565637 - 26565677
Alignment:
| Q |
152 |
tggtcttgcatttgataaataattaaatattgattcatatc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26565637 |
tggtcttgcatttgataaataattaaatattgattcatatc |
26565677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University