View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18516_low_11 (Length: 247)
Name: NF18516_low_11
Description: NF18516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18516_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 4 - 231
Target Start/End: Original strand, 2765885 - 2766112
Alignment:
| Q |
4 |
attagaatcagttggttagttaggagtagatacgggtcagttactttattagttactgcacccttactctacaaataggattattgtgtacacactgaac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
2765885 |
attagaatcagttggttagttaggagtagatacgggtcagttactttattagttagtgcacccttactctacaagtaggattattgtgtacacaccgaac |
2765984 |
T |
 |
| Q |
104 |
catactatattttaccaatcaagatgttttttaacgagcatttacctcatgaacttaactatgttctctttctctcacatgtgtatgatatctgacacta |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765985 |
catactatcttttaccaatcaagatgttttttaacgagcatttacctcatgaacttaactatgttctctttctctcacatgtgtatgatatctgacacta |
2766084 |
T |
 |
| Q |
204 |
cgatcccattattttcacatatgattca |
231 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
2766085 |
cgatcccattgttttcacatatgattca |
2766112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University