View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18516_low_6 (Length: 426)
Name: NF18516_low_6
Description: NF18516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18516_low_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 416; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 416; E-Value: 0
Query Start/End: Original strand, 3 - 426
Target Start/End: Complemental strand, 55102403 - 55101980
Alignment:
| Q |
3 |
actgagggatcagcagtcagaaatgagctacaagtgtaaccaggacctggggccatgaatgtaacattattaggagcttgtccaagtgaattttcttttt |
102 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55102403 |
actgagggatcagaagtcagaaatgagctacaagtgtaaccaggacctggggccatgaatgtaacattattaggagcttgtccaagtgaattttcttttt |
55102304 |
T |
 |
| Q |
103 |
cctccaagtttcttacttcaagttcaaatgaagacaatgaattgaaagaatcaacggctcgggcagagaggcggccaccacgacagcaatggtctgacct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55102303 |
cctccaagtttcttacttcaagttcaaatgaagacaatgaattgaaagaatcaacagctcgggcagagaggcggccaccacgacagcaatggtctgacct |
55102204 |
T |
 |
| Q |
203 |
gttttgtgacacatctggagatatatcaactatgattggatcttttttgcatgaatgtggcatctgagaaccactataagatgagcaatcacccctatca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55102203 |
gttttgtgacacatctggagatatatcaactatgattggatcttttttgcatgaatgtggcatctgagaaccactataagatgagcaatcacccctatca |
55102104 |
T |
 |
| Q |
303 |
gttgcaattgcaccactcattgaccatatcacctccttattagcccatgtccatcctagtttccaccctggtttgtctacatgccgatattgatgatggt |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55102103 |
gttgcaattgcaccactcattgaccatatcacctccttattagcccatgtccatcctagtttccaccctggtttgtctacatgccgatattgatgatggt |
55102004 |
T |
 |
| Q |
403 |
tttcaagagtcacccttgcctgtg |
426 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
55102003 |
tttcaagagtcacccttgcctgtg |
55101980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University