View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18517_high_13 (Length: 238)
Name: NF18517_high_13
Description: NF18517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18517_high_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 40654787 - 40654569
Alignment:
| Q |
18 |
tttgcaatgtatttgttaatgatatgtttagttcttggatcttgatagacattgttttgtatagatctttcagttctttgtttaaattttgtattgctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40654787 |
tttgcaatgtatttgttaatgatatgtttagttcttggatcttgatagacattgttttgtatagatctttcagttctttgtttaaattttgtattgctgt |
40654688 |
T |
|
| Q |
118 |
gtggcatggtggtgtatataacatttaaaatatgaatgttgaaacttatcatgcacaaatgctcacccacatgcaaaagcaactatgattatgagcttat |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40654687 |
gtggcatggtggtg--tataacatttaaaatatgaatgttgaaacttatcatgcacaaatgctcacccacatgcaaaagcaactatgattatgagcttat |
40654590 |
T |
|
| Q |
218 |
attccatcttgaattattatt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40654589 |
attccatcttgaattattatt |
40654569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University