View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18517_low_23 (Length: 227)
Name: NF18517_low_23
Description: NF18517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18517_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 42 - 165
Target Start/End: Original strand, 26761759 - 26761882
Alignment:
| Q |
42 |
aactgaatatgtttagctttttgagaaaatgctgaaaatggtagtagtgtaaaagacaaaaagttgtcaccgattataagaaagaaatctttcacattca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26761759 |
aactgaatatgtttagctttttgagaaaatgctgaaaatggtagtagtgtaaaagacaaaaagttgtcactgattataagaaagaaatctttcacattca |
26761858 |
T |
|
| Q |
142 |
ttgtactggaaaaccgctgtcttt |
165 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26761859 |
ttgtactggaaaaccgctgtcttt |
26761882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 162 - 222
Target Start/End: Original strand, 26761913 - 26761973
Alignment:
| Q |
162 |
ctttcatgttataagtacacaaattcctctacctcactacacaaaacccaagcaagattgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26761913 |
ctttcatgttataagtacacaaattcctctaccttactacacaaaacccaagcaagattgt |
26761973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 26761703 - 26761746
Alignment:
| Q |
18 |
atttgtttttgttacatcggcatcaactgaatatgtttagcttt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
26761703 |
atttgtttttgttacatcggcatcaactgaatatggtaagcttt |
26761746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University