View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18519_low_4 (Length: 249)
Name: NF18519_low_4
Description: NF18519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18519_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 12076220 - 12075983
Alignment:
| Q |
13 |
tgaaaatggtgattttcttgccgctgtttgctggctgaaaatggtgttggtttacaatcaaaatgaaaccctaaaccctgagcagcaagaaaacagctcg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
12076220 |
tgaaaatggtgattttcttgccgctgtttgctggctgaaaatggtattggtttacaatcaaaatgaaatcctaaaccttgagcagcaagaaaacagctcg |
12076121 |
T |
 |
| Q |
113 |
gggtttaggggtggaaaagggaacttcctaaacttttttca-tttaggccaaggacagttagctcattcttaacttcaatgacacaactcgtgtaccctc |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12076120 |
gggtttaggggtggaaaaggaaacttcctaaacttttttcattttaggccaaggacagttagctcattcttaacttcaatgacacaactggtgtaccctc |
12076021 |
T |
 |
| Q |
212 |
gatcctttgcgaagaaaaaaccctaatatttcagctcc |
249 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12076020 |
gatcctttgtgaagaaaaaaccctaatatttcagctcc |
12075983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University