View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1851_high_19 (Length: 238)

Name: NF1851_high_19
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1851_high_19
NF1851_high_19
[»] chr3 (1 HSPs)
chr3 (26-231)||(40371288-40371493)


Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 26 - 231
Target Start/End: Complemental strand, 40371493 - 40371288
Alignment:
26 acatgtggtggcaagtctgcatagctgaaaggtttaagtaatataattcaaaatgtgaaagctattataaaagcgaaaacattagatgggtaaataaagt 125  Q
    ||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
40371493 acatgtggtggcaagtctgcaaagctgaaaggtttaattaaaataaatcaaaatgttaaagctatcataaaagcgaaaacattagatgggtaaataaagt 40371394  T
126 tgtagacatagaagtaaaatatagcttgtttccaacttaacttggaacgcttcaaacaagtgcattcattatcactacaaatatctattagagatagagg 225  Q
    |||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||  ||||| ||||||||  | |||||||||||||||    
40371393 tgtagacatagaagtaaaatataggttatttccaacttaacttggaacgcttcaaacatgtgcatcgattattactacaaaggtatattagagatagagg 40371294  T
226 aaaaat 231  Q
    | ||||    
40371293 acaaat 40371288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University