View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1851_high_25 (Length: 235)
Name: NF1851_high_25
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1851_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 5015409 - 5015624
Alignment:
| Q |
1 |
ggttggcaggataaattcttatatcttcagcaggtcgcgaggtgctcattaaatctcttgcgtagtccattcttacaaacacatatcatggatcgtttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5015409 |
ggttggcaggataaattcttatatcttcagcaggtcgcgaggtgctcattaaatctcttgcgtagtccattcttacaaacacatatcatggatcgtttcc |
5015508 |
T |
 |
| Q |
101 |
tcttatccagatatgattatttgatgatattgtagcaatgataaagcaattttgatgtggttatagttacaataaaa-tacgctagctcaactgaaacaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5015509 |
tcttatccagatatgattatttgatgatattgaagcaatgataaagcaattttgatgtggttatagttacaataaaattacgctagctcaactgaaacaa |
5015608 |
T |
 |
| Q |
200 |
atgttgtaaaccttaa |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5015609 |
atgttgtaaaccttaa |
5015624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University