View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1851_low_19 (Length: 253)
Name: NF1851_low_19
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1851_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 50628481 - 50628373
Alignment:
| Q |
128 |
ttataaacatcaattgaatttagtctctaaactatcagaacttctccaaattttttatctaaactatataaaactagtaaattcaatcctctatgataag |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50628481 |
ttataaacatcaattcaatttagtctctaaactatcagaacttctccaatttttttatctaaactatataaaactagtaaattcaatcctctatgataag |
50628382 |
T |
|
| Q |
228 |
aactaaatt |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
50628381 |
aactaaatt |
50628373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 50628608 - 50628548
Alignment:
| Q |
1 |
aattaaaacttgcaatatagagaaaaaactttctaaatagacactgcaaaatttatttcac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50628608 |
aattaaaacttgcaatatagagaaaaaactttctaaacagacactgcaaaatttatttcac |
50628548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University