View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1851_low_22 (Length: 238)
Name: NF1851_low_22
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1851_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 26 - 231
Target Start/End: Complemental strand, 40371493 - 40371288
Alignment:
| Q |
26 |
acatgtggtggcaagtctgcatagctgaaaggtttaagtaatataattcaaaatgtgaaagctattataaaagcgaaaacattagatgggtaaataaagt |
125 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40371493 |
acatgtggtggcaagtctgcaaagctgaaaggtttaattaaaataaatcaaaatgttaaagctatcataaaagcgaaaacattagatgggtaaataaagt |
40371394 |
T |
|
| Q |
126 |
tgtagacatagaagtaaaatatagcttgtttccaacttaacttggaacgcttcaaacaagtgcattcattatcactacaaatatctattagagatagagg |
225 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||| ||||| |||||||| | ||||||||||||||| |
|
|
| T |
40371393 |
tgtagacatagaagtaaaatataggttatttccaacttaacttggaacgcttcaaacatgtgcatcgattattactacaaaggtatattagagatagagg |
40371294 |
T |
|
| Q |
226 |
aaaaat |
231 |
Q |
| |
|
| |||| |
|
|
| T |
40371293 |
acaaat |
40371288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University