View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1851_low_32 (Length: 233)
Name: NF1851_low_32
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1851_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 3681928 - 3682134
Alignment:
| Q |
16 |
gttatgacccatttgaattaaggaggtatatagattgtgtttggggaaacaaggaaggtgtgttcatatggcaaggtgaattgtcagatagatagtaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
3681928 |
gttatgacccatttgaattaaggaggtatatagattgtgtttggggaaacaaggaaggtgtgttcatatggcaaggtgaattgtcatatagatagttagt |
3682027 |
T |
|
| Q |
116 |
tttggtttagtgattatatagtttgaaataatgtgggagaatatggtggcatttctttatagcttgcatttggcattttggtagctagaagtttggttta |
215 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
3682028 |
tttggcttagtgattatatagattgaaataatgtaggagaatatggtggcatttctttatagcttgcatttggcattttggaaatcagaagtttggttta |
3682127 |
T |
|
| Q |
216 |
tattctt |
222 |
Q |
| |
|
||||||| |
|
|
| T |
3682128 |
tattctt |
3682134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University