View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1851_low_34 (Length: 222)
Name: NF1851_low_34
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1851_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 63 - 185
Target Start/End: Original strand, 8845615 - 8845734
Alignment:
| Q |
63 |
gaacctgagaaagttgaagcagaagaagaagaagattctgttataacaggtgaagattcgggttgtgaagaatcggattctgggtctggttcagaaaccg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8845615 |
gaacctgagaaagttgaagcagaa---gaagaagattctgttataacaggtgaagattcgggatgtgaagaatcgggttctgggtctggttcagaaaccg |
8845711 |
T |
 |
| Q |
163 |
ggttatgagatgatgggtttgaa |
185 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8845712 |
ggttatgagatgatgggtttgaa |
8845734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University