View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1851_low_35 (Length: 220)
Name: NF1851_low_35
Description: NF1851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1851_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 205
Target Start/End: Original strand, 29941734 - 29941931
Alignment:
| Q |
9 |
gagagaagaagagactatttaggaaaaactgtccaggtactgcctaattaatttagtgcatgtttagatcggcacgagtttcgtaaaatcacgatgacac |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29941734 |
gagagaagaggagactatttaggaaaaactgtccaggtactgcctaattaatttagtgcatgtttagatcggcacgagtttcgtaaaatcacgttgacac |
29941833 |
T |
 |
| Q |
109 |
tgtaaatttgttgaagctttttagtcaaaattaccgtaattttgtcaaactcacc-ttagtataaagaagtaataaacatgttttaattttttgttgt |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29941834 |
tgtaattttgttgaagctttttagtcaaaattaccgtaattttgtcaaactcacctttagtataaagaagtaataaacatgttttcattttttgttgt |
29941931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University