View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_high_18 (Length: 325)
Name: NF18521_high_18
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 104 - 310
Target Start/End: Original strand, 9313886 - 9314101
Alignment:
| Q |
104 |
ccacaatttttaaactaacaaacactagaaaacttcacaattccagtttgccataatccttgccaacaaccatatctattgcaccctctacgtccttgnn |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9313886 |
ccacaatttttaaactaaccaacactagaaaacttcacaattccagtttgccataatccttgccaacaaccaaatctattgcaccctctacgtccttgtt |
9313985 |
T |
 |
| Q |
204 |
nnnnnnnnnnnnnnnctttcttacaatcgaattatcaacttcatatgcaaactacaacacccctagcctcggat---------aatgataagttctttac |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
9313986 |
ttgtttttattttttctttcttacaatcgaattatcaacttcatatacaaactacaacacgcctagcctcggatgacataaaaaatgataagttctttac |
9314085 |
T |
 |
| Q |
295 |
cacttactcacatcct |
310 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9314086 |
cacttactcacatcct |
9314101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 10 - 106
Target Start/End: Original strand, 9313645 - 9313741
Alignment:
| Q |
10 |
ttatactagtatggttttgcaaatctggcgtgcattcaataattttggaacttatccttcgttgtgtttttcattacccagtcgatctttgtaacca |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9313645 |
ttattctagtatggttttgcaaatctggcgtgcattcaataattttggaacttatccttcgttgtgtttttcattacccagtcgatctttgtaacca |
9313741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 9289069 - 9289157
Alignment:
| Q |
18 |
gtatggttttgcaaatctggcgtgcattcaataattttggaacttatccttcgttgtgtttttcattacccagtcgatctttgtaacca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||| || |||||||||| |
|
|
| T |
9289069 |
gtatggttttgcaaatctggcgtgcattcaataactttggaacttatccttcattgtgtttttcattacgtagtcaatatttgtaacca |
9289157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 106
Target Start/End: Complemental strand, 9076102 - 9076044
Alignment:
| Q |
48 |
ataattttggaacttatccttcgttgtgtttttcattacccagtcgatctttgtaacca |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||| |||||| |||||| |
|
|
| T |
9076102 |
ataattttggaacttatccttcgttgtatttttcattacctagtcaatctttataacca |
9076044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University